While Anthropic's dispute with the Pentagon escalated over guardrails on military use, OpenAI LLC struck its own publicized ...

When Nandakishore Leburu was building LLM applications at LinkedIn, he learned that the models weren't the problem. The ...

A comprehensive guide to crypto programming in 2026, covering essential languages, smart contract development, DeFi applications ...

I tried training a classifier, then found a better solution.

Discover my best coding tools on Setapp Mac developers. From CodeRunner to TablePlus, see how these apps streamline your ...

Service providers must optimize three compression variables simultaneously: video quality, bitrate efficiency/processing power and latency ...

A group of hackers used both Claude Code and ChatGPT in a cybersecurity hack that lasted two and a half months.

The dorsal raphe nucleus (DRN) serotonergic (5-HT) system has been implicated in regulating sleep and motor control; however, its specific role remains controversial. In this study, we found that ...

This study provides an important and biologically plausible account of how human perceptual judgments of heading direction are influenced by a specific pattern of motion in optic flow fields known as ...

A reverse primer designed from EST aa306952 (5′–CGTAACACTCCATGGAAATCAGC–3′) and a forward primer designed from the ORF upstream to EST aa306952 (5′–ATGAAGGATGTTATGTCAGCTCTGT–3′) were used to amplified ...

Opus 4.7 utilizes an updated tokenizer that improves text processing efficiency, though it can increase the token count of ...

BACKGROUND: Genetic variants in components or regulators of the RAS-MAPK signaling pathway are causative for severe and early-onset hypertrophic cardiomyopathy (HCM) in patients with Noonan syndrome ...